а ы а ч ы И қ4% p<0,05. "Educatio" II (9), 2015 , I 6,4 Қ0 Щ<0,05 , Қ,қ Қ,6 3,9 III 4,0 II , Щ<0,0Қ. қ8% 34% - III I ИЦИ СКИ 78 қ0% қ0% II ( Ққ,0±0,6 . . *- 38% III , I . , , Щ<0,05 45%, , , I III . , , 4,5±0,5*З <0,05; ** - <0,01; З - -5,0±0,5*ЗҚ,қ ( ) , Д4Ж. : - , , - . . . - , III 1. . , II - . .қ). , , II , қ I қ 4қ,5% Щ<0,05 p<0,01. , 9,8±0,8 33% , АУКИ . ., . . № ққ09587 . . 2. // / . . . . 3. , : . . , . . . – №қ – .5Қ–52. : 4. . . . . . // Қ0.09.қ003 . .... - . : Қ4.03.03 / – , қ0Қ0. – ҚҚ3 . , / . . , . . . – .: , қ005, . , . . Қ06 . 5. Agafonova I.G., Eichhoff U., Kotelnikov V.N. Vasodilatation function of cerebral vessels at arterial hypertension in oxys rats. Applied Magnetic RОsШЧКЧМО. қ0Қ4. . 45. № 6. . 5қ7-536. ЭКСПРЕССИЯ ГЕНОВ RHOA, SEMA3B И CKAP2 ПРИ РАЗЛИЧНЫХ ТИПАХ ЛЕЙКОЗОВ . . ., Климов Евгений Александрович, , . . ., . . , EXPRESSION OF RHOA, SEMA3B, AND CKAP2 GENES IN LEUKEMIA OF DIFFERENT TYPES Eugene Klimov, Doc. of Sci., Group Leader, Faculty of Biology of Lomonosov Moscow State University, University Diagnostic Laboratory SEMA3B . . . . RHOA, SEMA3B CKAP2 RHOA CKAP2, . CKAP2 - ABSTRACT Transcriptional activity of RHOA, SEMA3B, and CKAP2 genes was assessed in blood samples of leukemia patients and healthy donors. In blood of healthy donors, RHOA and CKAP2 gene expression was not detected, and a low SEMA3B gene expression was observed. Significant elevation of expression of all three genes was shown in case of acute myelogenous leukemia. а ы а ч ы И "Educatio" II (9), 2015 ИЦИ СКИ 79 АУКИ In cases of remission of acute lymphoblastic leukemia and myelodysplastic syndrome, expression of all three genes was not detected. Long isoform of CKAP2 gene is highly expressed in most analyzed types of leukemia. : , , , RHOA, SEMA3B, CKAP2 Keywords: leukemia, gene expression, RT-PCR, RHOA, SEMA3B, CKAP2 . , , . . - RКs, RHOA ДҚЖ. , Дқ,3,4Ж. ТЧ ЯТЯШ Д5Ж. / , , , , , , – . ДҚҚЖ. N Қ , , - Д9Ж. , ДҚ0Ж. , , SEMA3B NЩқ ( қ0 SEMA3B Қ , , , SEMA3B қ , ДҚ4Ж ДҚ5Ж . қ ДҚ6Ж. ) (П 6- ) , S ( ДҚ7Ж. қ ДҚ7Ж. - қ , ДҚ8Ж. 53RHOA, SEMA3B , , Қ( Қ); 3( , 3); қ( ( - . «TrТгШХ RNA PrОЩ» , 60 , » « RHOA, SEMA3B - CKAPқ : CKAP2-F: TTCTGAATGCCTGAACTTGAT, CKAP2f-R: TTAACATCATGGGTTGGATCT, CKAP2s-R: AATTCCGAATTGTCTACTACACTG; 95° /Қ5”, 5қ° /Қ0”, 7қ° /30” (F) қ0” (S- ). қ% . VТTrКЧ (Biokom Ltd., Russia). GAPDH ( , Қ3%). . « – » GAPDH . , , 5 - – . RHOA CKAPқ SEMA3B . ( GAPDH). CKAPқ, - . - . . SEMA3B ( - RHOA CKAPқ, . CKAPқ GAPDH) , . . ): - GAPDH, Д9,Қ3Ж. CKAPқ қ); Қ); Қ). - GAPDH. қ - (s ). қ . - Қ ( Қ ( ). . , - қ), , GОЧPКФ® RT CШrО ( ). - (VEGF) – , , ДҚқЖ. [13]. - Д8Ж. RHOA 5’SEMA3B . - Д6,7Ж. RHOA , , , , ТЧ ЯТЭrШ - RHOA , 5); ( , RHOA ( ) . ( - - а ы а ч ы И "Educatio" II (9), 2015 . RHOA, SEMA3B 1. Etienne-Manneville S., Hall A. Rho GTPases in cell biology. Nature. 2002;420(6916):629-635. 2. Lessey E.C., Guilluy C., Burridge K. From mechanical force to RhoA activation. Biochemistry. 2012;51(38):7420-7432. 3. Parri M., Chiarugi P. Rac and Rho GTPases in cancer cell motility control. Cell Commun Signal. 2010;8:23. 4. Vial E., Sahai E., Marshall C.J. ERK-MAPK signaling coordinately regulates activity of Rac1 and RhoA for tumor cell motility. Cancer Cell. 2003;4(1):67-79. 5. Kamai T., Kawakami S., Koga F. et al. RhoA is associated with invasion and lymph node metastasis in upper urinary tract cancer. BJU Int. 2003;91(3):234238. 6. Liu N., Bi F., Pan Y. et al. Reversal of the malignant phenotype of gastric cancer cells by inhibition of RhoA expression and activity. Clin Cancer Res. 2004;10(18Pt1):6239-6247. 7. Aznar S., Fernandez-Valeron P., Espina C. et al. Rho GTPases: potential candidates for anticancer therapy. Cancer Lett. 2004;206(2):181-191. 8. Pan Y., Bi F., Liu N. et al. Expression of seven main Rho family members in gastric carcinoma. Biochem Biophys Res Commun. 2004;315(3):686-691. 9. . ., . ., . . . RHOA / . . қ006;40(5):865-877. 10. Yazdani U., Terman J.R. The semaphorins. Genome Biol. 2006;7:211. ИЦИ СКИ 80 CKAPқ ( АУКИ ) . 11. Roche J., Drabkin H.A. The role of semaphorins in lung cancer. Clin Lung Cancer. 2001;3(2):145-150. 12. Castro-Rivera E., Ran S., Thorpe P. et al. Semaphorin 3B (SEMA3B) induces apoptosis in lung and breast cancer, whereas VEGF165 antagonizes this effect. Proc Natl Acad Sci U S A. 2004;101( 31):11432-11437. 13. . ., . ., . . . SEMA3B . . 2009;43(3):439-445. 14. Maouche-Chretien L., Deleu N., Badoual C. et al. Identification of a novel cDNA, encoding a cytoskeletal associated protein, differentially expressed in diffuse large B cell lymphomas. Oncogene. 1998;17(10):12451251. 15. . ., . ., . . . CKAPқ (LBҚ), . . қ00қ;36(6):985-989. 16. Jin Y., Murakumo Y., Ueno K. et al. Identification of a mouse cytoskeleton-associated protein, CKAP2, with microtubule-stabilizing properties. Cancer Sci. 2004;95(10):815-821. 17. Bae C.D., Sung Y.S., Jeon S.M. et al. Up-regulation of cytoskeletal-associated protein 2 in primary human gastric adenocarcinomas. J Cancer Res Clin Oncol. 2003;129(11): 621-630. 18. Tsuchihara K., Lapin V., Bakal C. et al. Ckap2 regulates aneuploidy, cell cycling, and cell death in a p53-dependent manner. Cancer Res. 2005;65(15):6685-6691. ФАРМАКОЛОГИЧЕСКАЯ КОРРЕКЦИЯ ФЕТОПЛАЦЕНТАРНОЙ НЕДОСТАТОЧНОСТИ С СИНДРОМОМ ЗАДЕРЖКИ РОСТА ПЛОДА Клычева Ольга Игоревна , , . . . ., , . . ., . Лазарева Галина Анатольевна , , . Хурасева Анна Борисовна , , . PHARMACOLOGICAL CORRECTION OF FETOPLACENTAL INSUFFICIENCY WITH FETAL GROWTH RETARDATION SYNDROME Klichiova Olga, postgraduate student Department of Obstetrics and Gynecology, Faculty of Postgraduate Education, Kursk State Medical University, Kursk